Resumo

Background Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and bacteremia in children. Recent estimates of child deaths caused by S. pneumoniae range from 700.000 to 1 million every year worldwide. Effective interventions are available, including pneumococcal conjugate vaccine. Inflammation is a prominent feature of S. pneumoniae infections. Indeed, an intense host immune response to infection is thought to contribute significantly to the pathology of pneumococcal pneumonia and meningitis. ZmpB is a zinc metalloprotease identified as a novel virulence factor capable of inducing inflammation in an animal model. It was shown that the first 300-400 amino acids are conserved and the remaining sequence of gene is variable among strains. An allelic variation of zmpB, containing the terminal sequence TCTTAGGTTATGCTTCAAATAAATATAAACAACAATCTAAAACAGATGGTGAGTCTGTTCTAAGTGATGA, contribute to the virulence of S. pneumoniae. Material and methods In this study, 93 isolates of S. pneumoniae obtained between January 2009 and December 2010 from patients of Porto Alegre, Brazil, were included. DNA was extracted from culture and a PCR with specific primers to a region of allelic variation of zmpB was conducted. All isolates in which amplification of the fragment described above was observed were sequenced by ABI310 system (Applied Biosystems). Isolates were serotyped by a multiplex PCR. Results and Discussion Isolates were recovered from blood (64%), cerebrospinal fluid (20%), pleural effusion (2%), sputum (2%), and unknown sites (12%). Among 93 isolates 21 (22.6%) showed amplification of the fragment of zmpB, and 17 (81%) of them were isolated from a normally sterile site. Only isolates belonging to serotypes 14, 9V, 7F, 23F and 15A, showed amplification of the zmpB allelic fragment. We observed that the similarity with invasive strain TIGR4 was >95%, except for one isolate belonging to serotype 15A (similarity 87%). The frequency of amplification of the allelic fragment in each serotype was 85.7% (14), 66.6% (7F), 33.3% (9V and 15A), 16.6% (23F), and 25% (isolates that could not be serotyped by multiplex PCR). Invasive pneumococcal disease is associated with some pneumococcal serotypes as well as some host factors. Serotypes 14, 7F and 9V are frequently involved in invasive disease in non-vaccinated populations and in our study those strains showed high frequency of allelic variation of zmpB, and high similarity with TIGR 4. Isolates belonging to these serotypes showed a similar molecular background, and a higher frequency of a zmpB allele, what may contribute to the severity of pneumococcal disease.