Resumo

Background: The São Paulo Zoo Park Foundation (SPZPF) has a collection of about 3,200 wild animals, including a representative number of mega vertebrates and several species of the Brazilian fauna. The park is located in an area of 204 acres of native Atlantic Forest, considered one of the world's richest biomes. Objectives: The objective of this study was to identify the microbiological diversity of the OCU of SPZPF, specially the diversity of Bacillus genus that can predominate in this kind of niche due to its high temperature. Methods: Genomic DNA samples were obtained using Wizard Genomic DNA purification kit (Promega cat. No. A1125) following the manufactures instructions. The amplification of the 16S rRNA gene was performed using 30–50 ng of DNA in 50 ml reaction mixtures. Each PCR contained 2 mmol MgCl2, 200 mmol of each dNTP (10mM dNTP´s), 0.3 mmol of the primers 27f (5´-AGAGTTGATCCTGGCTCAG-3´) and 1525r (5´-AAGGAGGTGWTCCARCC-3´), 2 U Taq DNA polymerase (Invitrogen) Thermal Cycler of the following conditions: initial extension at 94°C for 2 min, 30 cycles at 94°C for 1 min, 55°C for 1 min and 72°C for 3 min and a final extension at 72°C for 10 min. Sequence analyses were conducted using a 3500 Genetic Analyzer Sequencer (Applied Biosystems). The primers used in the sequencing reactions were 27f, 782r (5´ ACCAGGGTATCTAATCCTGT 3’) and 1401r (5´ CGGTGTGTACAAGACCC 3´). The sequencing program consisted of 25 cycles at 95°C for 20s, 50°C for 15s and 60°C for 60s. The 16S rRNA gene sequences of the strains were compared to bacterial sequences deposited at GenBank. Phylogenetic trees were constructed using the neighbour-joining method. The diversity of bacterial isolates from the OCU of SPZPF was studied and eleven genera were identified by 16S rRNA gene sequences. Conclusions: The genus Bacillus, often found in such exotic environmental, was the most frequently found. Of the 270 bacterial isolates obtained during the composting process and submitted to analysis of 16S rRNA gene sequence, 140 were identified as belonging to the Bacillus genus (51%), and the 16S rRNA gene sequencing technique using the phylogenetic approach classified some isolates as B. subtilis, B. safensis and B. pumilus, beyond the presence of unclassified species of Bacillus isolates, which may indicate the presence of possible new species. The taxonomy approach indicates the presence of putative new species belonging to Bacillus genus.